Programme Ambition Recherche de l'AMSN

Le PAR à mi-chemin 2008 - 2012

Vincent Palmier — 2010-07-20T08:58:46Z

Bonjour à tous,

cette période estivale va être - je l'espère pour vous tous - l'occasion de trouver un peu de repos et de recul sur ce premier semestre 2010 largement alimenté par la crise économique et ses messages forts.

Avant de connaître ce repos, nous vous proposons une synthèse de près de 2 ans de travail pour monter, faire connaître et développer le programme Ambition Recherche.

Ce site vous permet d'en comprendre les mécanismes, visiter les initiatives et (surtout) de suivre les projets de recherche financés. C'est pourquoi nous ne reviendrons que sur les étapes majeures de 2010.

La phase I demandait 230 000 € de financement d'ici 2012 (les trois projets actuellement en cours), et correspondait à l'objectif que nous avions fixé à fin juin. C'est fait. Les projets vont pouvoir travailler en toute sérénité, d'autant que nous finançons dans certains cas des frais de personnel, ce qui nous donne une responsabilité sociale forte.

La phase II peut donc démarrer afin de poursuivre notre ambition de financer au moins 400 000 € d'ici 2012. Pourquoi se donner tant de mal ?

A - parce que nous avons pris une place significative dans le financement de la recherche médicale contre la maladie. Ce soutien à la recherche est plus que fondamental dans sa capacité à attirer et retenir les talents nécessaires au combat contre le SNI. Pouvoir s'appuyer régulièrement sur la communauté des malades est unanimement reconnu comme clé par les services de recherche.

B - parce que la publication du 18 mai démontre l'excellence des équipes françaises et les réels progrès dans la compréhension des mécanismes de la maladie. Les équipes évoquent aujourd'hui les futurs travaux de "thérapie génique" à horizon 2 à 10 ans : c'est tout près ! Comment imaginer ne pas nous battre à leur côté ? Participer à la bataille comme nous l'avons fait, c'est déjà très bien. Mais vous, adhérents, devez nous dire si vous souhaitez continuer à travers vos actions & vos dons. Nous avons 8 000 € sur les 170 000 € de l'objectif, et vous savez maintenant que c'est possible, on a déjà fait mieux !

C - enfin par ce que nos donateurs, et en particulier les entreprises qui nous soutiennent, croient en nous. Outre les dons à la recherche, nous avons pû louer un stand sur la prestigieuse Route du Rhum, il est vrai avec l'aide fantastique de notre parrain et de sa compagne. Cette dynamique peut être cultivée dans les prochains mois, il faut simplement y croire.

Exprimez-vous sur ce bilan et donnez-nous votre point de vue, c'est important. Nous vous ferons une proposition avant la fin de l'année.

A mi-parcours, les objectifs intermédiaires sont atteints, l'ambition reste intacte, la crédibilité en plus. Nous sommes satisfaits de ce bilan tout en nous posant une nouvelle question essentielle : AMSN voudra-t-elle, pourra-t-elle, jouer un rôle majeur contre la maladie dans les dix prochaines années ? C'est vous qui détenez la réponse.

Au nom de l'équipe AR et du Bureau AMSN, je vous souhaite d'excellents congès et tous mes voeux de santé.

Bien solidairement,

Vincent PALMIER

T2 2010 : un trimestre exceptionnel

Vincent Palmier — 2010-07-01T06:54:55Z

Bonjour à tous,

nous sommes le 1er juillet et le bilan du deuxième trimestre est tout chaud : un record de dons ! Avec plus de 15 000 €, les quatrièmes trimestres 2008 & 2009 sont battus, ce qui est formidable dans cette période de crise. Ces dons ont permis d'obtenir le financement de la phase I avant fin juin, ce qui était l'objectif. La publication dans SCIENCE a sans doute pesé dans la confiance des donateurs, et nous avons reçu en parallèle 4 000 € du Groupe Michelin pour retenir un stand au moment de la Course du Rhum fin octobre.

Alors bien sûr pas de temps de repos ! L'organisation de ce stand est déjà notre sujet principal, avec la mise au point d'une phase II efficace qui devra être adoptée lors de la prochaine AGO.

Une phase II qui compte déjà 8 000 € de dons pour un objectif fin d'année de 40 000 €. Si le rythme est atteint, nous pourrons envisager une dynamique comparable à celle de la phase I.

De quoi nous motiver.

Récolte des dons à juin 2010

Vincent Palmier — 2010-06-16T08:46:42Z

Nous devions donner un point de l'objectif fin juin (avoir récolté 230 000 € soit le montant nécessaire au financement de la phase 1 du programme). Mais il n'est pas utile d'attendre la fin du mois, c'est gagné !

L'impact de cette collecte est considérable car elle apporte une sérénité nouvelle pour les chercheurs et l'association jusqu'en 2012 ! Cela va permettre de nous concerter pour inventer la suite dès cette année, forts d'une crédibilité totale sur la première phase du programme.

Dores et déjà, l'année 2010 sera exceptionnelle :

publication à la une de Science Signaling de l'un de nos projets financés.

partenariat renforcé avec notre parrain Marc LEPESQUEUX et présence AMSN à la Normandy Channel Race et bientôt à la Route du Rhum.

atteinte des objectifs de don pour le bouclage de la phase 1.

Gestion de l'association renforcée (bientôt un nouvelle offre).

Des dons exceptionnels de particuliers ou d'événements majeurs (lire prochain article "Rugby").

Que ces succès 2010 ne nous fassent pas oublier que tout peut s'arrêter très vite si nous, adhérents, ne nous engageons pas dans le développement de l'association au jour le jour. Alors, rejoignez-nous et lancez vos actions !

Le Bureau

les inscriptions se bousculent !

Vincent Palmier — 2010-06-04T18:06:38Z

Route du Rhum 2010 : 49 inscrits, 33 en attente La Route du Rhum 2010 fait recette. A cinq mois du départ, qui sera donné le 31 octobre de Saint-Malo, l'organisation recense déjà 49 bateaux inscrits et 33 en attente. La Class 40 est la catégorie la plus représentée avec 23 inscrits et 23 pré-inscrits devant la catégorie Rhum (LHT entre 39 et 59 pieds) qui compte 6 bateaux et 6 autres en attente. Il y aura six unités (+1) dans la classe ultime, huit (+1) monocoques de 60 pieds et enfin six (+2) Multi 50. Pour rappel, 74 concurrents avaient participé à la précédente édition en 2006, ce nombre d'engagés pouvant être battu lors de cette neuvième édition si toutes ces inscriptions se confirment.

articles de presse du 18 mai 2010

Vincent Palmier — 2010-05-28T17:15:55Z

Lycée agricole de La Plaine aux FONDETTES (37)

Vincent Palmier — 2010-05-27T17:21:34Z

C'est avec beaucoup d'émotion et de reconnaissance que nous avons lu le courrier discret de quatre élèves du CFA agricole de FONDETTES (37) qui ont organisé un loto pour soutenir notre combat, l'un des élèves ayant un proche touché par la maladie.

A la clé un chèque pour la recherche médicale de 200 € ! Voici un don que nous n'oublierons pas et qui ira directement & intégralement vers les trois projets retenus de notre programme Ambition Recherche.

Un immense merci de la part de nos malades et de leurs proches, votre geste nourrit notre enthousiasme et nos espoirs.

Le Bureau

L'article du 18 mai 2010 in extenso en anglais

Vincent Palmier — 2010-05-25T06:32:43Z

RESEARCH Introduction Results c-mip is detected in the kidneys of patients with MCNS and other glomerular diseases c-mip overproduction in podocytes in vitro inhibits nephrin phosphorylation and causes cytoskeletal disorganization c-mip transgenic mice develop nephrotic proteinuria without inflammatory lesions or cell infiltration The podocytes of c-mip transgenic mice have an abnormal phenotype c-mip binds Fyn and inhibits the interactions of Fyn with nephrin and N-WASP RNAi directed against c-mip prevents induction of proteinuria in LPS-treated mice Discussion Materials and Methods Patients Immunohistochemistry and confocal microscopy Plasmid constructs, cell culture, and transient transfections Immunoprecipitations and Western blot analyses Generation of stable podocyte cell lines with inducible c-mipexpression Generation of c-mip transgenic mice Proteinuria, serum albumin, and creatinine analysis Light and electron microscopy studies Measurement of foot processes, glomerular basement membrane, and slit pores In vitro activity and stability assays of Stealth RNAi (siRNA) siRNA treatment Statistics Supplementary Materials References and Notes c-mip Impairs Podocyte Proximal Signaling and Induces Heavy Proteinuria Shao-yu Zhang1,2, Maud Kamal1,2*, Karine Dahan1,2*, André Pawlak1,2*, Virginie Ory1,2, Dominique Desvaux1,2, Vincent Audard1,2, Marina Candelier1,2, Fatima Ben Mohamed1,2, Marie Matignon1,2, Christo Christov3,4, Xavier Decrouy4, Veronique Bernard5, Gilles Mangiapan6, Philippe Lang1,2,7,8, Georges Guellaën1,2, Pierre Ronco9,10,11, and Djillali Sahali1,2,7,8

1 INSERM, UMR 955, Equipe 21, F-94010 Créteil, France. 2 UMRS 955, Equipe 21, Université Paris-Est Créteil Val-de-Marne, F-94010 Créteil, France. 3 Assistance publique-Hôpitaux de Paris (AP-HP), Groupe hospitalier Henri Mondor-Albert Chenevier, Service d'histologie, Département de Pathologie, F-94010 Créteil, France. 4 INSERM, UMR 955, Plate-Forme d'Imagerie Cellulaire et Tissulaire, F-94010 Créteil, France. 5 Unité INSERM, UMR 952, CNRS UMR7224, Université Pierre et Marie Curie, F-75252 Paris, France. 6 Centre hospitalier intercommunal, Service de pneumologie, F-94010 Créteil, France. 7 AP-HP, Groupe hospitalier Henri Mondor–Albert Chenevier, Service de Néphrologie, F-94010 Créteil, France. 8 Institut francilien de recherche en néphrologie et transplantation Henri Mondor, F-94010 Créteil, France. 9 INSERM, UMRS-702, F-75020 Paris, France. 10 Université Pierre et Marie Curie–Paris 6, 75252 Paris Cedex 05, France. 11 AP-HP, Hôpital Tenon, Service de Néphrologie et Dialyses, F-75020 Paris, France.

Abstract : Idiopathic nephrotic syndrome comprises several podocyte diseases of unknown origin that affect the glomerular podocyte, which controls the permeability of the filtration barrier in the kidney to proteins. It is characterized by the daily loss of more than 3 g of protein in urine and the lack of inflammatory lesions or cell infiltration. We found that the abundance of c-mip (c-maf inducing protein) was increased in the podocytes of patients with various acquired idiopathic nephrotic syndromes in which the podocyte is the main target of injury. Mice engineered to have excessive c-mip in podocytes developed proteinuria without morphological alterations, inflammatory lesions, or cell infiltration. Excessive c-mip blocked podocyte signaling by preventing the interaction of the slit diaphragm transmembrane protein nephrin with the tyrosine kinase Fyn, thereby decreasing phosphorylation of nephrin in vitro and in vivo. Moreover, c-mip inhibited interactions between Fyn and the cytoskeletal regulator N-WASP (neural Wiskott-Aldrich syndrome protein) and between the adaptor protein Nck and nephrin, potentially accounting for cytoskeletal disorganization and the effacement of foot processes seen in idiopathic nephrotic syndromes. The intravenous injection of small interfering RNA targeting c-mip prevented lipopolysaccharide-induced proteinuria in mice. Together, these results identify c-mip as a key component in the molecular pathogenesis of acquired podocyte diseases.

IntroductionBack to TopThe kidney filters 180 liters of plasma daily through the glomerular filtration barrier, a specialized glomerular structure consisting of a fenestrated endothelial cell layer, a glomerular basement membrane, and a layer of epithelial cells called podocytes, which cover the external side of the glomerular capillary loop (1). The podocyte is a terminally differentiated epithelial cell immersed in the urinary space and anchored to the underlying glomerular basement membrane by large cell expansions, known as foot processes (2). The slit diaphragm is a 40-nm junction structure that links the interdigitating foot processes from neighboring podocytes (2). The glomerular filtrate passes first through the fenestrated endothelium, then through the glomerular basement membrane, and finally through the slit diaphragm, which serves as the principal size-selective macromolecular filter that prevents the passage of large proteins into the urinary space (2). The effacement of foot processes is a common ultrastructural feature of nephrotic syndrome (defined by massive urinary protein loss), regardless of its etiology (3). It may result from structural or functional changes in the subcellular compartments of the podocyte, including the cytoskeleton, slit diaphragm, the glomerular basement membrane interface, and apical domains (4). The molecular mechanisms underlying these alterations remained elusive until the identification of mutations associated with familial forms of steroid-resistant nephrotic syndrome. These mutations were identified in genes encoding nephrin, a transmembrane protein that functions as an adhesion molecule ; podocin, a lipid raft–associated protein ; CD2-associated protein (CD2-AP), an adaptor protein ; the cytoskeletal protein -actinin-4 ; the transient receptor potential channel 6 (TRPC6) ; and phospholipase C, a regulator of activated heterotrimeric guanosine triphosphate binding protein (G protein) signals (5–10).

In addition to playing a structural role in the slit diaphragm, nephrin is involved in proximal signal transduction, which is initiated after clustering of nephrin in specialized sphingolipid- and cholesterol-enriched microdomains in the cell membrane, called lipid rafts (11). A proximal event downstream of nephrin clustering is activation of the Src family protein tyrosine kinase Fyn, which binds to and phosphorylates the cytoplasmic domain of nephrin. Phosphorylated nephrin interacts with podocin, CD2-AP, and the p85 subunit of phosphatidylinositol 3-kinase (PI3K), thereby activating the Akt signaling pathway (12–14). Nephrin phosphorylation also promotes the sequential recruitment of the adaptor protein Nck and activated Wiskott-Aldrich syndrome protein (WASP) to lipid rafts. The two members of the Nck family of adaptor proteins, Nck1 and Nck2, interact with N-WASP through an Src homology 3 (SH3) domain and with the cytoplasmic domain of nephrin through an SH2 domain (13). N-WASP, a member of the WASP family proteins, is a potent inducer of Arp2/3-mediated actin polymerization (15). Nck activates N-WASP and promotes cytoskeletal rearrangement (13). In lipid rafts, Fyn interacts with and phosphorylates N-WASP (13, 16). The interaction of Fyn with CD2-AP and synaptopodin links nephrin-mediated proximal signaling to the actin cytoskeleton (17). The slit diaphragm thus acts as a signaling platform on which multiple signals converge (4).

We previously screened T cells of patients with minimal change nephrotic syndrome (MCNS) experiencing a relapse and found that c-mip (c-maf inducing protein) abundance was increased in these patients (18). The predicted structure of the 86-kD c-mip protein includes an N-terminal region containing a pleckstrin homology (PH) domain, a central region containing docking sites for 14-3-3 proteins, protein kinase C (PKC), and extracellular signal–regulated kinase (ERK), an SH3 domain similar to the p85 regulatory subunit of PI3K, and a C-terminal region containing a leucine-rich repeat (LRR) domain.

Here, we report increased abundance of c-mip in the podocytes of patients with acquired idiopathic nephrotic syndrome, which covers three different types of lesions of unknown origin in which the podocyte is the main target of injury, including MCNS, a subset of focal and segmental glomerulosclerosis (FSGS), and membranous nephropathy (MN). A feature common to these diseases is generalized edema resulting from massive proteinuria, hypoalbuminemia, and sodium retention. These conditions may be complicated by infectious and thromboembolic events. MCNS and FSGS account for 70 and 20%, respectively, of the cases of idiopathic nephrotic syndrome in children, and for 25% each of the cases in adults (19–21). The hallmark of MCNS is an absence of inflammatory injury and immune complex deposits in the glomeruli, whereas FSGS is characterized by adhesion of the glomerular tuft to Bowman's capsule (22). MCNS seems to be a single reasonably uniform entity combining immune and podocyte disorders, whereas FSGS appears to be a heterogeneous disease of immune or nonimmune origin (23). MN, which is rare in children, is characterized by the presence of prominent immune complex deposits between the podocytes and the glomerular basement membrane (24). The effacement of podocyte foot processes is a lesion common to these diseases and suggests cytoskeletal alterations.

c-mip abundance was also increased in an experimental mouse model of nephrotic proteinuria induced by lipopolysaccharide (LPS). Transgenic mice overproducing c-mip in the podocytes developed a nephrotic syndrome without inflammatory lesions or cell infiltrations. c-mip bound Fyn directly in vitro and in vivo and prevented the interaction of Fyn with nephrin and N-WASP, thereby decreasing nephrin phosphorylation and causing cytoskeletal disorganization. The knockdown of c-mip by RNA interference (RNAi) techniques prevented the development of proteinuria in LPS-treated mice. Thus, c-mip appears to be a key player in podocyte dysfunction.

ResultsBack to Top c-mip is detected in the kidneys of patients with MCNS and other glomerular diseases The pathogenesis of MCNS involves the dysfunction of lymphocytes and podocytes through an unknown mechanism (23). This syndrome can be induced into remission (as defined by the disappearance of proteinuria) by steroid therapy, but relapses are frequent and may require cyclosporine treatment. Our initial studies led us to examine whether the abundance of c-mip increased in the podocytes of patients with MCNS. We screened 15 adult patients with MCNS relapse (table S1). In situ hybridization (ISH) revealed that the c-mip signal was largely restricted to the podocytes ; this finding was confirmed by immunohistochemical analysis with a rabbit polyclonal antibody directed against c-mip (Fig. 1A). We also carried out confocal microscopy analyses of kidney biopsy specimens labeled with c-mip and nephrin antibodies. We were unable to detect c-mip in normal human kidney, either in the glomeruli or in extraglomerular structures, whereas nephrin was visualized (Fig. 1B, upper panel). In contrast, in biopsy specimens from relapsing MCNS patients, c-mip was detectable and diffusely distributed along the external side of the capillary loops (Fig. 1B, lower panel). To determine the abundance of c-mip during remission, we performed immunolabeling for c-mip on kidney biopsy specimens from five MCNS patients who were steroid dependent and received cyclosporine-based therapy because of frequent relapses. c-mip abundance was low in two patients and undetectable in the other three patients (table S1).

View larger version (98K) : [in this window] [in a new window]

Fig. 1. The abundance of c-mip increases in the glomeruli of patients with MCNS. (A) Representative immunohistochemical analysis of serial sections from normal human kidney (NHK) and kidney biopsy specimens from patients with MCNS relapse. Scale bars, 20 µm. (B) Confocal microscopy detection of nephrin (red) and c-mip (green) in normal human kidney tissues (upper panel) and MCNS biopsies (lower panel). The basal amount of c-mip was below the limit of detection, whereas c-mip was visualized along the peripheral capillary loops in patients with MCNS. The c-mip and nephrin were colocalized in the glomerulus. Scale bars, 10 µm.

We screened patients with idiopathic MN, FSGS, HIV-associated nephropathy (HIVAN), immunoglobulin A (IgA) nephropathy, and diabetic nephropathy. All patients presented with nephrotic proteinuria at the time of biopsy (table S1). Kidney biopsy specimens from patients with primary FSGS were analyzed by both ISH (fig. S1) and immunohistochemistry (fig. S2). We detected c-mip in only 4 of the 10 patients studied. In these cases, the course of the disease was complicated by frequent relapses requiring additional cyclosporine treatment. The distribution of c-mip was similar to that observed in MCNS biopsies, although less nephrin was detected. In the other FSGS patients in whom c-mip was not detected, the glomerular disease occurred in the context of obesity and hypertension (4 patients), sarcoidosis (1 patient), and strongyloidiasis (1 patient). These results suggest that c-mip abundance may be increased in a particular subgroup of patients with FSGS, possibly those with disease of immune origin. The abundance of c-mip was high in 11 of 12 biopsies of patients with idiopathic MN (figs. S1 and S2). We did not detect c-mip messenger RNA (mRNA) in the glomeruli of patients with nephrotic proteinuria caused by diabetic nephropathy, IgA nephropathy, or HIVAN (table S1 and fig. S1). These findings suggest that increased c-mip abundance is not because of nephrotic proteinuria.

c-mip overproduction in podocytes in vitro inhibits nephrin phosphorylation and causes cytoskeletal disorganization To understand the effects of c-mip on podocyte function, we established podocyte cell lines that stably expressed a tetracycline-inducible plasmid encoding c-mip. In non-induced cells, c-mip was not detectable in podocytes, which displayed a well-developed actin network containing stress fibers (long intracellular bundles of actin filaments) (Fig. 2A). The induction of c-mip expression by tetracycline was associated with reduced stress fiber formation (Fig. 2A).

View larger version (40K) : [in this window] [in a new window]

Fig. 2. Stable overexpression of c-mip in podocytes induces phenotypic alterations. (A) Confocal microscopy analysis of phalloidin staining. c-mip–overexpressing podocytes display a loss of stress fibers, whereas the actin network is well preserved in non-induced stable c-mip transfectants. Scale bars, 10 µm. (B) Western blot of protein lysates from non-induced (–) and induced (+) c-mip stable transfectants. The induction of c-mip inhibits the phosphorylation of nephrin and triggers the inactivation of Fyn and Akt. Data from two independent experiments are shown.

Next, we sought to determine whether these morphological alterations were associated with changes in the abundance of proteins involved in podocyte signaling. We detected c-mip 48 hours after the addition of tetracycline (Fig. 2B). c-mip contains a PH domain, and some proteins containing this domain are recruited to lipid rafts upon activation (25). Fyn, which provides the early proximal signal, is located in lipid rafts (26). Immunoblotting of podocyte protein lysates showed that c-mip overproduction triggered the accumulation of inactive Fyn [Fyn phosphorylated at Tyr528 (pTyr528-Fyn)], suggesting that c-mip prevents Fyn activation (Fig. 2B). Consequently, the amount of phosphorylated nephrin (p-nephrin) was reduced upon induction of c-mip, although the total abundance of nephrin appeared to be unaltered (Fig. 2B). The induction of c-mip was also associated with decreased Akt activation, as assessed by phosphorylation of Ser473 of Akt (pSer473-Akt) (Fig. 2B). On the other hand, c-mip did not affect the protein abundance of CD2-AP and podocin (Fig. 2B). Together, these results suggest that c-mip interferes with proximal signals, inhibits nephrin activation, and promotes actin cytoskeleton disorganization.

c-mip transgenic mice develop nephrotic proteinuria without inflammatory lesions or cell infiltration To analyze the functional consequences of c-mip up-regulation in vivo, we used a targeting system in which a single copy of the transgene was inserted into the X-linked hypoxanthine phosphoribosyltransferase (Hprt) locus by homologous recombination (fig. S3). A complementary DNA (cDNA) containing the coding sequence of c-mip was inserted under the control of the nephrin promoter to drive c-mip expression in podocytes. The founders were crossed with wild-type C57Bl/6 and backcrossed repeatedly to obtain a homogeneous C57BL/6 genetic background. All the mice analyzed here were hemizygous males [Tg(+)] from the F4 to F10 generations. Tg(+) mice developed nephrotic proteinuria with a strong predominance of albumin (Fig. 3, A and B). Light microscopy analysis of periodic acid–Schiff (PAS) reagent–stained kidney sections from 8-week-old proteinuric Tg(+) mice showed that glomeruli exhibited a normal architecture (fig. S4). Renal function was preserved, as shown by the plasma creatinine concentrations measured at 3 and 6 months (fig. S4). The tubular structures and interstitium displayed no pathological changes, but some tubules were filled with protein (fig. S5, upper panel). c-mip was detected in the peripheral capillary loops of proteinuric mice, whereas it was undetectable in wild-type mice (fig. S5, middle panel). No immunoglobulin or complement deposits were observed upon immunofluorescence analysis (fig. S5, lower panel). We did not detect c-mip either in tubular structures or in the interstitium. Pathological examinations of other organs did not reveal any common alterations and no abnormal mortality was noted during the observation period.

View larger version (60K) : [in this window] [in a new window]

Fig. 3. c-mip transgenic mice develop nephrotic proteinuria without inflammatory lesions or cell infiltrations. (A) Proteinuria was assessed by the proteinuria/creatinine ratio (UPr/UCr). UPr/UCr was 3.5 ± 0.75 in 8-week-old female heterozygotes [Tg(+/–), n = 26 mice], 28.5 ± 4.5 in male hemizygote Tg(+) transgenic mice (n = 34 mice), and 2.6 ± 0.5 in wild-type (WT) mice (n = 12 mice). Only the results of F8 to F10 generation are presented. (B) Urine samples (5 µl) and BSA (15 µg) were resolved by SDS-PAGE and gels were stained with Coomassie Blue. Alb, albumin. (C and D) Kidney sections from 8-week-old c-mip transgenic and WT mice were examined. (C) Tg(+) mice display podocyte flattening and the effacement of foot processes. The effacement of foot processes is associated with the disappearance of slit diaphragms, which are replaced by occluding junctions (arrow). Scale bars : top and middle, 0.5 µm ; bottom, 0.1 µm. (D) The foot processes are evenly spaced in WT mice. Scale bars, top, 1 µm ; bottom, 0.1 µm. (E) Morphometric analysis of foot process effacement indicating that the width of the podocyte soles (in nanometers) in Tg(+) mice is twice that in the WT. n = 100 podocytes from three mice per genotype were analyzed. Data are means ± SEM. Mann-Whitney test, *P <0.05.

We assessed the amount of c-mip protein in MCNS and Tg(+) glomeruli by immunostaining tissue sections for c-mip and examining stacks of confocal images taken throughout the entire thickness of the glomeruli (20 images per glomerulus). We quantified the fluorescence of the most representative slice from the image stack. The differences in size between the glomeruli of mice and humans precluded direct comparison ; therefore, the site-specific fluorescent labeling lining the capillary loop was normalized to total glomerular area (table S2 and fig. S6).

Electron microscopy analysis of glomeruli in Tg(+) mice revealed the effacement of foot processes with flattened podocytes (as usually observed in patients with nephrotic proteinuria), whereas wild-type mice had normal foot processes (Fig. 3, C and D). Slit diaphragms appeared narrow in most glomeruli and were absent in some areas, with the formation of occluding junctions between neighboring foot processes. These features were not observed in normal littermates. The podocyte foot processes were significantly wider in Tg(+) than in wild-type mice (Fig. 3E). The glomerular basement membrane appeared normal. The tubules and interstitium were normal. Immunogold labeling revealed that c-mip was predominantly, but not exclusively, located in the major and secondary foot processes close to the slit diaphragm (fig. S4).

We followed the course of glomerular disease in Tg(+) mice from birth until the age of 1 year. Determination of urinary protein concentration ranges in newborn F7 generation mice by dipstick indicated that proteinuria (30 mg/dl) was present in 70% of 5-day-old mice and in 79% of 3-week-old Tg(+) mice (table S3). Electron microscopy studies showed areas of foot process effacement, as well as foot processes with an abnormal morphology (fig. S7). We then determined urinary protein concentration ranges in four groups of mice, at various ages, from 1 to 12 months (fig. S8A). On the basis of these concentration ranges, glomerular disease appeared to be established in these mice by the age of 1 to 3 months. Histological analyses of kidney sections, including 30 to 50 glomeruli per mouse, were carried out in a blind fashion, and scores were determined for 10 mice for each age group. At 3 months of age, glomeruli of proteinuric Tg(+) mice exhibited a normal morphology (fig. S8B). At 6 months of age, 25% of glomeruli showed mesangial hypercellularity. At 1 year of age, 25% of the glomeruli displayed expanded mesangial matrices and some FSGS-like lesions, similar to those observed in some patients with MCNS who go on to develop FSGS. We found no correlation between urinary protein concentration ranges and the extent of the mesangial changes.

The podocytes of c-mip transgenic mice have an abnormal phenotype We performed confocal microscopy analysis for various markers of mature podocytes. Nephrin and phosphorylated nephrin exhibited continuous staining along the peripheral capillary loop in wild-type mice. In Tg(+) glomeruli, nephrin was less abundant at the podocyte membrane, where granular staining was observed and lower amounts of nephrin phosphorylation were detected (fig. S9). Our in vitro studies suggested that c-mip interfered with podocyte proximal activation (Fig. 2B). Consistent with these findings, 8- and 10-week-old Tg(+) mice had less phosphorylated nephrin than their wild-type littermates, although the total abundance of nephrin was unchanged (Fig. 4A). These alterations were associated with an increase in the abundance of the inactive forms of Fyn (pTyr528-Fyn) and Akt (not phosphorylated at Ser473) (Fig. 4B). Little c-mip was detected in wild-type mice, suggesting that the abundance of c-mip may be kept low under normal conditions. The inactivation of Akt was confirmed by immunofluorescence analyses of kidney sections. The pSer473-Akt form was visualized along the peripheral capillary loop at the site of the podocytes in wild-type mice but was not detected in Tg(+) mice (Fig. 4C). The amount of pSer473-Akt was also significantly lower in the kidneys of patients with MCNS than in those of patients with IgA nephropathy or diabetic nephropathy (Fig. 4C and fig. S10), highlighting the pathophysiological relevance of this mouse model to the human disease.

View larger version (28K) : [in this window] [in a new window]

Fig. 4. Podocytes of c-mip transgenic mice have an abnormal phenotype. (A) Immunoprecipitation of nephrin from two different Tg(+) glomerular lysates, followed by Western blotting for phosphorylated nephrin and total nephrin. The amount of phosphorylated nephrin is reduced (right panel). Data from two independent experiments are shown. (B) Western blot analysis of glomerular protein lysates from 10-week-old WT mice and Tg(+) mice. Fyn is mostly present in the inactive form, whereas the amount of pSer473-Akt is reduced. Data from two independent experiments are shown. (C) Lower abundance of phosphorylated Akt (pSer473-Akt) in the glomeruli (G) of patients with MCNS disease and in Tg(+) mice than in NHK and WT mice, respectively. Scale bars, 10 µm.

c-mip binds Fyn and inhibits the interactions of Fyn with nephrin and N-WASP Because Akt was present in its inactive form in glomeruli from MCNS biopsies and in c-mip Tg mice, and because c-mip decreased the amount of nephrin phosphorylation in vitro, we investigated whether c-mip interfered with Fyn-mediated proximal signaling. In a preliminary analysis, c-mip protein was not detected in human embryonic kidney (HEK) cells (fig. S11A). In coimmunoprecipitation experiments with protein lysates from transfected HEK cells, c-mip bound Fyn (fig. S12A, upper panel). Endogenous Fyn was also immunoprecipitated with c-mip (fig. S12A, upper panel). This interaction seemed to be direct, because purified recombinant c-mip was immunoprecipitated with recombinant Fyn (fig. S12A, middle panel). Coimmunoprecipitation analysis with deletion mutants of c-mip revealed that c-mip interacted with Fyn through its PH domain (fig. S12A, lower panel).

We next coexpressed c-mip, nephrin, and Fyn (to mimic biochemical events seen in nephrotic syndromes) and determined whether nephrin retained its ability to interact with Fyn. Coimmunoprecipitation experiments showed that c-mip prevented the interaction of nephrin with Fyn (fig. S12B, upper panel). We then investigated whether the inability of nephrin to interact with Fyn influenced its phosphorylation status. Coexpression of nephrin and Fyn increased the phosphorylation of nephrin at Tyr1208 ; this effect was reduced by coexpression of c-mip (fig. S12B, lower panel).

Activated Fyn binds and phosphorylates N-WASP (13, 16), thereby facilitating the anchoring of the cytoskeleton to lipid rafts (27). Immunoprecipitation experiments with protein lysates from transfected HEK cells indicated that Fyn bound to N-WASP, an interaction that was blocked in the presence of c-mip (fig. S12C).

c-mip coimmunoprecipitated with Fyn from glomerular extracts from Tg(+) mice, but not those from wild-type mice (Fig. 5A). The amount of nephrin immunoprecipitated with Fyn in Tg(+) mice was lower than that in wild-type mice (Fig. 5B). Moreover, Tg(+) mice displayed lower amounts of nephrin phosphorylation, even though the amounts of nephrin immunoprecipitated in wild-type and Tg(+) mice were comparable (Fig. 4A). Nck binds N-WASP through its SH3 domain and nephrin through its SH2 domain (12, 13, 16). The interactions of Fyn with N-WASP (Fig. 5C) and Nck with nephrin (Fig. 5, D and E) were weaker in the presence of c-mip. Together, these results suggest that c-mip interacts with Fyn and alters proximal signaling and cytoskeleton reorganization by disrupting the interactions of Fyn with N-WASP and nephrin, respectively.

View larger version (39K) : [in this window] [in a new window]

Fig. 5. Interactions among nephrin, Nck, and N-WASP are altered in c-mip Tg(+) mice. (A) c-mip coimmunoprecipitates with Fyn in Tg(+) glomerular lysates (n = 2 experiments). Immunoprecipitation (IP) of Fyn from WT and Tg(+) glomerular lysates is followed by Western blotting with antibody against Fyn (n = 2 experiments), showing that equal starting amounts are present. (B) The amount of nephrin present in Fyn complexes is lower in glomerular lysates from Tg(+) mice than in those from WT mice (n = 2 experiments). (C) The interaction of N-WASP with Fyn is decreased in Tg(+) mice relative to that in WT mice (n = 2 experiments). (D) Immunoprecipitation of Nck from WT and Tg(+) glomerular lysates, followed by Western blotting with antibody against nephrin (n = 2 experiments). The interactions of Nck with nephrin are decreased in Tg(+) mice relative to WT mice. (E) Immunoprecipitation of nephrin from three different Tg(+) glomerular lysates, followed by Western blotting with antibody against Nck. The interaction of nephrin with Nck is reduced in Tg(+) mice relative to that in WT mice.

RNAi directed against c-mip prevents induction of proteinuria in LPS-treated mice To determine whether the silencing of endogenous c-mip could prevent the development of proteinuria, we took advantage of our observations that the increase in c-mip abundance in LPS-treated mice occurred at the same time as the induction of proteinuria (Fig. 6A). In this model, we confirmed that c-mip was present in podocyte foot processes and that it bound Fyn (Fig. 6A). We detected c-mip mostly in flattened podocytes, rather than in podocytes with normal foot processes (fig. S13). c-mip was not detected in splenocytes from LPS-treated mice. However, we nevertheless investigated whether the induction of c-mip in podocytes from LPS-treated mice required T cell activation. In severe combined immunodeficient (SCID) mice, which lack both cellular and humoral immunity, LPS injection induced significant proteinuria and increased c-mip abundance in podocytes (Fig. 6B).

View larger version (77K) : [in this window] [in a new window]

Fig. 6. Knockdown of c-mip prevents the development of nephrotic proteinuria. (A) Detection of c-mip in LPS-treated Balb/c mice. Upper panel : Immunohistochemistry analysis showing greater abundance of c-mip in podocytes. Scale bars, 20 µm. Lower panel : Immunoprecipitation of glomerular extracts from LPS-treated mice with anti-Fyn or mouse IgG. (B) Increased abundance of c-mip in the podocytes of LPS-treated SCID mice compared to those of untreated SCID mice. Scale bars, 20 µm. (C) Effects of c-mip siRNA injection on LPS-treated Balb/c mice. Balb/c mice (n = 10 mice) received a single injection of c-mip siRNA (10 mg/kg) coupled to Alexa Fluor 647 into the internal jugular vein, and after 30 min were injected intraperitoneally with LPS (200 µg). Controls include mice injected with LPS (n = 5 mice) or Invivofectamine (Inv) (n = 5 mice) and non-injected mice (NI, n = 5 mice). Urine was collected over a 24-hour period and the kidneys were harvested and processed for immunohistochemistry. Upper panel : Alexa Fluor 647 fluorescence in kidney sections demonstrated that c-mip–siRNA duplexes were delivered to podocytes. Scale bars, 10 µm. Middle panel : Immunohistochemistry analysis showed that mice treated with LPS and c-mip siRNA contained less c-mip than mice treated with LPS only. Scale bars, 10 µm. Lower left panel : QPCR analysis of c-mip expression in mouse kidney. mRNA abundance is expressed with respect to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Data are means ± SEM (*P < 0.05, Mann-Whitney test). Lower right panel : Proteinuria was significantly lower in c-mip siRNA–treated mice than in mice treated with LPS alone (***P = 0.001, Mann-Whitney test).

We used RNA interference to knock down c-mip in vivo. Thirty minutes after injection of fluorescently labeled c-mip siRNA (10 mg/kg) into the internal jugular vein, we injected LPS [200 µg in phosphate-buffered saline (PBS)] into the peritoneum. Proteinuria was decreased by 70% in LPS-treated mice injected with siRNA (Fig. 6C, lower panel), compared to those injected with LPS alone [proteinuria/creatinine ratio (UPr/UCr), 4.52 ± 1.75 compared to 12.51 ± 1.35, respectively]. The transfection reagent (Invivofectamine) slightly increased proteinuria above the values observed for non-injected wild-type mice (6.5 ± 1.41 compared to 2.25 ± 0.9, respectively), an effect that may be due to its cationic structure. Confocal immunofluorescence analysis showed that c-mip siRNA was efficiently delivered to podocytes (Fig. 6C, upper panel). The abundance of c-mip protein and mRNA in podocytes was lower in mice injected with c-mip siRNA and LPS and increased in mice receiving LPS alone (Fig. 6C, middle and lower panels). The amounts of nephrin and phosphorylated nephrin were reduced in many glomeruli of LPS-treated mice relative to those of mice treated with both siRNA and LPS (Fig. 7A). The amount of phosphorylated Akt (pSer473-Akt) was significantly reduced in LPS-treated mice, whereas no significant difference was observed between wild-type mice and LPS- and siRNA-treated mice (Fig. 7B). These results suggest that it may be possible to prevent proximal signaling disorders and the development of proteinuria by inhibiting increases in the abundance of c-mip.

View larger version (46K) : [in this window] [in a new window]

Fig. 7. c-mip siRNA prevents the inactivation of nephrin and Akt. (A) Confocal microscopy analysis of phosphorylated nephrin (green) and total nephrin (red) in kidney sections. The relative abundance of nephrin and phosphorylated nephrin were assessed by quantifying the specific glomerular fluorescence intensity (lining the capillary loops) in three-dimensional stacks of images taken by confocal microscopy and normalized to total glomerular area. Twenty glomeruli were analyzed for each set of conditions. Data are means ± SEM. Nephrin phosphorylation was lower in LPS-treated mice than in siRNA-treated mice (*P < 0.05, Mann-Whitney test). The decrease in nephrin abundance is less marked in these mice. Scale bars, 10 µm. (B) Confocal microscopy analysis of phosphorylated Akt (pSer473-Akt) in kidney sections from mice treated with LPS alone or with LPS and siRNA. Scale bars, 10 µm. Data are means ± SEM. The amount of pSer473-Akt is significantly lower in LPS-treated mice (n = 3 mice) than in LPS- and siRNA-treated mice (n = 3 mice) (20 glomeruli were analyzed per mouse, *P < 0.05, Mann-Whitney test).

DiscussionBack to TopThe molecular pathogenesis of the most common acquired glomerular diseases associated with nephrotic syndrome remains to be elucidated. In this study, we provide evidence that (i) the abundance of c-mip is increased in the podocytes of patients with MCNS and MN and a subset of patients with FSGS ; (ii) the overproduction of c-mip in the podocytes of transgenic mice induces heavy proteinuria with podocyte foot process effacement without inflammatory lesions and immune complex deposits ; (iii) c-mip binds Fyn and prevents the phosphorylation of nephrin and the recruitment of N-WASP and Nck, thus disturbing downstream signaling events, ultimately resulting in cytoskeleton disorganization and protein leakage ; and (iv) the silencing of endogenous c-mip by RNAi prevents the induction of proteinuria in LPS-treated mice.

The higher abundance of c-mip in the podocytes of patients with MN, a glomerular disease characterized by subepithelial immune complex deposits, was unexpected. As in patients with MCNS, massive proteinuria in patients with MN occurs in the absence of inflammatory cells (24). In both experimental and human MN, immune complexes forming electron-dense deposits lead to complement activation and generation of the C5b-9 complex [also known as membrane attack complex (MAC)], which in turn induces alterations in the podocyte membrane and slit diaphragm, resulting in proteinuria (28). However, several lines of evidence suggest that the mechanisms underlying the induction of proteinuria may be more complex. First, the remission of nephrotic syndrome may be observed in patients with MN, despite the persistence of electron-dense deposits (29), which suggests that additional mechanisms may be required to alter slit diaphragm signaling. Second, active and passive Heymann nephritis can be induced in rats lacking complement component C6 and incapable of forming C5b-9 (30, 31), suggesting that the local activation of complement is not required for proteinuria induction. Third, the transplantation of kidneys from rats with Heymann nephritis, an experimental rat model of MN, into syngeneic hosts induces the clearing of subepithelial immune deposits with no decrease in proteinuria (32). Fourth, both MCNS and MN podocytopathies are associated with a decrease in nephrin abundance and changes in the distribution of nephrin (33), as observed in our c-mip transgenic mice. The injuries initiating the nephrotic syndrome differ in these two diseases targeting podocytes, but our results suggest that the underlying mechanisms may use common signaling pathways.

T lymphocytes and podocytes constitutively produce several proteins, such as CD2-AP, Fyn, and Nck, that play key roles in signaling and cytoskeleton reorganization in both cell types. Mutations or genetic ablations of the genes encoding CD2-AP and Fyn are associated with glomerular filtration defects and immune disorders, respectively (34, 35). In contrast, c-mip is a protein that is low in abundance under basal conditions but induced in both cell types in pathological situations, thus forming a possible bridge between immune alterations and podocyte dysfunction.

Tg mice expressing c-mip specifically in podocytes under the control of the nephrin promoter developed a glomerular disease characterized by heavy proteinuria with a predominance of albumin, diffuse effacement of foot processes, and an absence of immune deposits. The similarities between kidney biopsy findings for patients with podocyte diseases and c-mip Tg mice suggest that mice constitute a suitable model for investigations of the mechanisms underlying nephrotic proteinuria.

We have deciphered the molecular mechanisms downstream from c-mip induction that lead to changes in signaling at the slit diaphragm, resulting in cytoskeletal disorganization and protein leakage through the glomerular capillary wall. Our studies in stably transfected podocyte cell lines with inducible c-mip expression and a transgenic mouse model provide support for a critical inhibitory role of c-mip in podocyte proximal signaling. Fyn was mostly detected in an inactive form in podocytes overexpressingc-mip in vitro and in vivo, consistent with a blockade of proximal signaling. c-mip bound Fyn and prevented the interaction of nephrin with Fyn, thereby decreasing nephrin phosphorylation. The inability of Fyn to phosphorylate nephrin may facilitate the interaction of nephrin with β-arrestin2 and its subsequent endocytosis and degradation (36). In agreement with our in vitro data, nephrin phosphorylation abundance was lower in the podocytes of adult Tg(+) mice than in those of wild-type mice. The phosphorylation of Akt was consistently lower in the glomeruli of patients with MCNS but increased in those of patients with diabetic nephropathy, except in areas of glomerulosclerosis.

Nephrin phosphorylation promotes the recruitment of Nck and subsequent interactions of Fyn with N-WASP in lipid rafts. Thus, decreased phosphorylation disrupts the interactions of nephrin with Nck and N-WASP, thereby blocking nephrin signaling and leading to cytoskeletal disorganization, a key event in the induction of proteinuria (13, 37). These data suggest that c-mip dissociates Fyn-mediated early podocyte proximal signals from cytoskeletal organization in podocytes.

LPS induces podocyte foot process effacement (38) and decreases the abundance of nephrin mRNA (39). We show here that many glomeruli in LPS mice displayed partial loss of nephrin and phosphorylated nephrin and lower amounts of Akt phosphorylation. These phenotypes were not observed in mice injected with c-mip siRNA. These results suggest that the increase in c-mip abundance in podocytes was sufficient to induce nephrotic syndrome, providing support for the hypothesis that c-mip inhibits proximal signaling. In addition to podocytes, LPS affects other kidney compartments, including endothelial and tubular cells, but several findings suggest that the decrease in proteinuria results from a specific effect of c-mip siRNA on podocytes. First, genome-wide expression studies of glomerular mRNA from LPS-treated and control mice, combined with immunohistochemistry, show that LPS predominantly affects podocytes and their actin cytoskeleton (39). Indeed, LPS induces the down-regulation of many podocyte genes, including those encoding -actinin-4, nephrin, podocin, synaptopodin, and Fyn (39). LPS-induced proteinuria in SCID mice is correlated with an increase in the abundance of c-mip in podocytes, in the absence of T or B cell infiltration of the kidney and patent tubular or interstitial lesions.

Finally, the fact that transgenic mice expressing c-mip develop nephrotic syndrome, whereas silencing of endogenous c-mip prevents its development in LPS-treated mice, suggests that c-mip plays an essential role in this disorder and identifies this protein as a potential key target for the development of new treatments.

Materials and MethodsBack to Top Patients The cohort of adult patients analyzed in this study was from our clinical department. The characteristics of these patients are summarized in table S1. All adult patients with MCNS relapse had proteinuria amounts exceeding 3 g per 24 hours and severe hypoalbuminemia at the time of blood sampling, which was performed before steroid treatment. The diagnosis of kidney disease was confirmed by renal biopsy. MCNS and MN were clinically classified as idiopathic in all cases. The control cohort included adult patients with glomerular diseases with proteinuria in the nephrotic range. Normal renal samples were supplied by the hospital tissue bank (biological resource platform, Hôpital Henri Mondor). They were obtained from patients undergoing nephrectomy for a polar kidney tumor.

Immunohistochemistry and confocal microscopy ISH was performed as described elsewhere (40). For immunofluorescence analyses, podocytes were cultured on Lab-Tek slides (Nalge Nunc) at a subconfluent density, then fixed by incubation with 2% paraformaldehyde and 4% sucrose in PBS for 10 min at room temperature. Cells were permeabilized by incubation with 0.3% Triton X-100 for 10 min, and then blocked by incubation in 1% bovine serum albumin (BSA) for 30 min. The slides were incubated overnight at 4°C with the indicated antibodies. They were then washed and incubated with the appropriate secondary biotinylated antibody (Vector Laboratories) for 10 min at room temperature, followed by fluorescein–avidin DCS (Vector Laboratories). F-actin was visualized by incubation with fluorescein isothiocyanate (FITC)–conjugated phalloidin (Molecular Probes). The slides were covered with Vectashield mounting medium containing DAPI (4',6-diamidino-2-phenylindole) and viewed under a fluorescence microscope (Zeiss, Germany) with the appropriate filters.

Immunohistochemistry studies on kidney sections were performed as described elsewhere (40). Immunofluorescence studies on kidney tissues were performed on 4-µm cryostat sections fixed in acetone for 10 min, air-dried for 30 min at room temperature, then incubated in PBS for 3 min and blocked with 1% BSA in PBS. The sections were incubated with the indicated antibodies for 1 hour at room temperature, washed with PBS, and incubated with FITC- or Texas Red–conjugated secondary antibodies. For dual fluorochrome labeling, the slides were simultaneously incubated with rabbit antibody against c-mip and mouse antibody against synaptopodin. The slides were then washed with PBS and simultaneously incubated with FITC-conjugated goat antibody against rabbit IgG and cyanine 3-conjugated sheep antibody against mouse IgG. Sections were examined by fluorescence microscopy (Zeiss). The relative amounts of c-mip protein in MCNS kidney biopsy specimens and Tg(+) mice were determined as follows. Immunofluorescence staining was performed on tissue sections of the same thickness from MCNS kidney biopsy specimens and Tg(+) kidney tissues. Kidney sections from five biopsies and six 3-month-old Tg(+) mice, totaling 50 glomeruli each, were analyzed. Tissue sections were viewed under a confocal laser scanning microscope (LSM510-META, Zeiss) with a Plan-Apochromat 63x, 1.4 numerical aperture oil immersion objective. Acquisitions were performed with an argon laser (excitation wavelength, 488 nm) and fluorescence emission was collected with the META channel between 500 and 600 nm. The pinhole was set at 1.0 Airy unit (0.8-mm optical slice thickness). The images were processed with ImageJ software (http://rsb.info.nih.gov/ij/, version 1.39e). The lower and upper thresholds of fluorescence intensity (F) were fixed at 2000 and 4095 pixels, respectively. We used a high cutoff value for the lower threshold to eliminate nonspecific signals. The area of specific labeling (lining the capillary loops) was normalized with respect to total glomerular area (S = labeled area/total area) to account for the differences in total glomerular areas between mice and humans. This ratio was determined for each glomerulus. The semiquantification (Q) of site-specific fluorescent labeling was determined as follows : Q = F x S.

Plasmid constructs, cell culture, and transient transfections A cDNA encoding c-mip was obtained from patients with MCNS and a cDNA encoding N-WASP was obtained from a podocyte cell line (41). The sequences of primers and the polymerase chain reaction (PCR) conditions are summarized in table S4. Reverse transcription was performed with Superscript II (Invitrogen) and PCR amplification was performed with the Phusion high-fidelity DNA polymerase (Finnzyme). The cDNA products were inserted into the pDonor plasmid. The full-length c-mip and N-WASP cDNAs were transferred into pDest40 by recombination (Invitrogen). The Fyn plasmids were provided by M. D. Resh (Memorial Sloan-Kettering Cancer Center) and J. Huot (Centre de recherche du Centre Hospitalier Universitaire de Québec). Transient transfection assays were carried out in HEK 293 cells (American Type Culture Collection), which were maintained in Dulbecco's modified Eagle's medium containing 10% fetal calf serum. The cells were transiently transfected by the Nanofectine-1 method, according to the instructions provided by the manufacturer (PAA). The cells were allowed to recover for 24 hours, washed three times in cold PBS, and lysed. Cells from the same number of passages were used to minimize variations in transfection efficiency. The native recombinant c-mip was generated with the baculovirus expression system by inserting the human c-mip cDNA between the Bam HI and Xho I restriction sites of the transfer vector, pBacPAK9, in accordance with the manufacturer's instructions (Clontech). Sf9 insect cells were then cotransfected with the recombinant vector and baculovirus BacPak6 viral DNA. A high-titer recombinant viral stock was obtained and used for subsequent infection of Sf9 cells. Insect cells were infected at a multiplicity of infection of 10 in BacPAK complete medium. Ninety hours after infection, cells were harvested and lysed on ice by incubation for 5 min in complete Lysis-B, EDTA-free buffer (Roche Diagnostic GmbH). The recombinant c-mip was purified by a combination of preparative electrophoresis and gel electroelution (fig. S11B). The concentration of recombinant c-mip protein was determined by densitometric analysis of Coomassie Blue–stained gels containing known amounts of BSA as standard.

Immunoprecipitations and Western blot analyses The primary antibodies used in this study included antibodies against phospho-Akt (Ser473 and Thr308), Akt, N-WASP (Cell Signaling), phospho-Fyn (Tyr528, Tyr418), Fyn (BD Biosciences), Nck 1/2, and Akt 1/2/3 (Santa Cruz), rabbit antibody against CD2-AP (Santa Cruz Biotechnology), guinea pig antibody against nephrin (Progen), and rabbit antibody against podocin (from C. Antignac, INSERM). The antibody against phosphorylated nephrin was provided by L. B. Holzman (University of Michigan Medical School). The c-mip polyclonal antibody was produced in rabbits immunized with acrylamide gel sections containing the c-mip protein. The specificity of the c-mip antibody was checked by Western blotting and immunohistochemistry, by first incubating the antibody with the recombinant c-mip protein purified from supernatants of baculovirus-infected Sf9 cells. In both cases, this previous incubation resulted in an absence of signal (fig. S11, A to D). The recombinant Fyn protein was purchased from EMD Biosciences. Cell protein extracts from podocytes or HEK 293 cells were prepared in lysis buffer B [150 mM NaCl, 10 mM tris-HCl (pH 7.5), 2 mM dithiothreitol (DTT), 10% glycerol, 1 mM EDTA, 1% NP-40, 1 mM protease inhibitors, 1 mM NaF, and 1 mM sodium orthovanadate]. Glomerular protein extracts were prepared in lysis buffer A [50 mM tris-HCl (pH 7.5), 150 mM NaCl, 2 mM EDTA, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM phenylmethylsulfonyl fluoride, 1 mM protease inhibitors, 1 mM NaF, and 1 mM sodium orthovanadate]. The protein lysates were resolved by SDS–polyacrylamide gel electrophoresis (SDS-PAGE) and analyzed by Western blotting with the indicated antibodies. Similar procedures were used to prepare total kidney lysates, except the protein extracts were dialyzed overnight at 4°C in the same buffer. Immunoprecipitations were carried out with 2 mg of precleared glomerular or total kidney protein lysates and 4 µg of antibody. The complexes were precipitated with 75 µl of protein A/G–Sepharose (GE Healthcare Bio-Sciences AB). For coimmunoprecipitation, cell lysates containing equal amounts of protein were precleared by incubation with protein G–Sepharose for 1 hour at 4°C. The beads were saturated with 5% BSA for 4 hours before use. The precleared protein lysates were incubated with the appropriate antibody for 2 hours at 4°C, and 50 µl of protein G–Sepharose beads was then added and the incubation was continued overnight at 4°C. The beads were washed six times with lysis buffer B supplemented with 0.5% NP-40 and bound proteins were resolved by SDS-PAGE in a 10% polyacrylamide gel, transferred to nitrocellulose membranes, and processed for immunoblotting. The controls for the immunoprecipitations included the use of nonimmune rabbit or mouse IgG (Alpha Diagnostics) instead of primary antibody.

Generation of stable podocyte cell lines with inducible c-mip expression Conditionally immortalized mouse podocytes have been described elsewhere (41). Inducible podocyte cell lines were generated with the T-Rex system (Invitrogen). Before transfection, podocytes were maintained at 60% confluence under permissive conditions : RPMI 1640 medium containing 10% fetal calf serum, penicillin (100 U/ml), streptomycin (100 µg/ml), and interferon- (IFN-, 50 U/ml) at 33°C. Podocytes were cotransfected with a c-mip expression plasmid (pcDNA4/TO) and a regulatory plasmid (pcDNA6/TR) encoding the Tet repressor. In the absence of tetracycline, the Tet repressor binds to the promoter of the inducible c-mip expression plasmid, preventing transcription. Cotransfection was performed with 1 µg of c-mip-pcDNA4/TO and 6 µg of pcDNA6/TR with the Amaxa system (Amaxa GmbH). A plasmid encoding the LacZ gene was used as a control. After transfection, the cells were allowed to recover for 24 hours in fresh RPMI medium under permissive conditions. Dual selection was then performed by adding blasticidin (5 µg/ml) and zeocin (125 µg/ml). Podocytes were cultured under these conditions for 4 weeks for the isolation of stable cell lines expressing both the Tet repressor andc-mip. Differentiation was induced by maintaining stable podocyte cell lines at 37°C without IFN- for 14 days in the presence of blasticidin and zeocin. The expression of c-mip was induced on day 14 by adding tetracycline to the medium culture (1 µg/ml) and incubating for 48 hours. Podocytes were then lysed for protein extraction.

Generation of c-mip transgenic mice Transgenic mice were obtained with a targeting system based on the reconstitution of a functional X-linked hypoxanthine-guanine phosphoribosyltransferase (HPRT) locus (absent from the parental embryonic stem cells) by homologous recombination, such that only embryonic stem cells with the correct integration survive HAT (hypoxanthine aminopterin thymidine) medium selection (42). Three plasmids were used to construct the HPRT targeting vectors. The first, provided by C. R. J. Kennedy (Ottawa Health Research Institute), comprises an 8.3-kb fragment of the murine promoter and the 5' untranslated (5'UTR) region of the nephrin gene (43). The full-length coding sequence of the human c-mip was inserted into the Xho I site, downstream from the nephrin segment. A 13.275-kb fragment containing the transgene (nephrin segment and c-mip) was excised by digestion with Nar I and Pvu I. The transgene was blunted by treatment with the Klenow fragment and ligated to the Eco RI–digested, blunted, and dephosphorylated pEntr1A gateway vector with the Quick ligase (New England Biolabs). The transgene was then subcloned by homologous recombination into the pDest vector upstream of the promoter and the exon 1 of the human HPRT gene. The recombinant clones were checked by restriction analysis with Bam HI, Eco RV, and Hind II. The resulting plasmid was linearized with the Age I restriction enzyme and microinjected into BPES (hybrid c57BL/6 and 129) embryonic stem cells. Homologous recombinants were selected on HAT-supplemented medium containing 0.1 mM hypoxanthine, 0.0004 mM aminopterin, and 0.016 mM thymidine (Sigma). HAT-resistant clones were confirmed by PCR and expanded by culture for 10 days. Targeted BPES (hybrid C57BL/6/129) cells were injected into wild-type (WT) blastocytes, enhancing the contribution of the embryonic stem lineage to chimera and ensuring 100% germline transmission. Male chimeras with 100% brown coat color were crossed with WT C57BL/6 females to obtain agouti offspring. Female agouti offspring were backcrossed with WT C57BL/6 males to obtain hemizygous male mice. Successive backcrosses were performed to obtain a homogeneous C57BL/6 genetic background (more than five generations). Mice were genotyped by PCR analysis of tail genomic DNA. We used one pair of primers specific for the transgene (the 5' primer was located in the nephrin promoter, whereas the 3' primer was specific for c-mip) and another pair of murine primers that detects the WT HPRT allele in heterozygous females, but not the reconstituted HPRT allele (containing part of the human HPRT gene) in homozygous females. The sizes of the c-mip and HPRT PCR products were 817 and 300 base pairs, respectively. All experiments involving animals were conducted in accordance with French laws.

Proteinuria, serum albumin, and creatinine analysis Individual mice were housed in metabolic cages (Techniplast). Urine was collected over a 24-hour period and this process was repeated five times for each individual. Proteinuria (mg/ml) and serum albumin and creatinine concentrations (mg/ml) were measured with the appropriate kits from Advia Chemistry 1650 (Bayer Healthcare AG). The urine of neonates was analyzed with urine dipsticks (Multistix ; Bayer). Urine samples (5 µl) were analyzed by SDS-PAGE and the gels were stained with Coomassie Brilliant Blue.

Light and electron microscopy studies For light microscopy, kidneys from WT and c-mip-transgenic mice were incubated for 16 hours in Dubosq-Brazil, dehydrated, embedded in paraffin, cut into sections, and stained with hematoxylin and eosin or PAS reagent. We analyzed 30 to 50 glomeruli from each mouse. The kidney specimens used for electron microscopy were cut into small pieces, fixed by incubation with 2.5% glutaraldehyde in 0.1 M cacodylate buffer for 1 hour at pH 7.4, washed in the same buffer, postfixed by incubation in 1% OsO4for 45 min, and placed in 0.5% aqueous uranyl acetate for 1 hour at 4°C. Tissues were dehydrated in graded ethanol, infiltrated with a mixture of propylene oxide and Epon resin, and embedded in Epon. Semithin sections were cut on an ultramicrotome (Leica, EM UC6) and stained with toluidine blue for the selection of glomeruli. Ultrathin sections were cut and poststained with uranyl acetate and lead citrate, and then examined under a Philips Tecnai 12 electron microscope. To identify targeting of endogenous c-mip in the podocyte, mice were treated by intraperitoneal injection of LPS (200 µg in a final volume of 200 µl). Twenty-four hours later, mice were anesthetized and perfused through the left ventricle with 0.2% glutaraldehyde in 0.1 M cacodylate buffer. Kidney specimens were then processed as above.

Measurement of foot processes, glomerular basement membrane, and slit pores Negatives of electron micrographs (magnification, x6000) were scanned at a resolution of 600 dots per inch (dpi) on an Epson Perfection 1200 Photo scanner (Epson Europe). Measurements were made on the resulting photographs with QWin Pro V2.4 software (Leica). The system was calibrated with the marker bar on the electron micrographs. Five random open capillary loops in each of five randomly selected glomeruli per specimen were chosen for measurements of the length and width of the glomerular basement membrane with the image analysis software. We also manually counted the number of podocyte foot processes in each loop and expressed the results as the number of foot processes per 10-µm glomerular basement membrane length. A mean result for 25 capillary loops was obtained. For each specimen, the width of 100 individual slit pores was determined from the same set of digitized electron micrographs. Slit pore width was determined by measuring the diameter of the narrowest region of the pore between two adjacent foot processes. The width of podocyte foot processes was measured with the same marker bar on the negatives of electron micrographs. Mann-Whitney tests were used for statistical analysis.

In vitro activity and stability assays of Stealth RNAi (siRNA) We selected three sequences from the open reading frame that are conserved between humans, rats, and mice for testing in vitro. The siRNA sequences were G6 (forward strand : UCCUGCUAUGAAGAGUUCAUCAACA), G8 (forward strand : CGGACCUUUCUCAGCAAGAUCCUCA), and G10 (forward strand : AAGAGUUCAUCAACAGCCGCGACAA). The siRNA were synthesized by Invitrogen. The sense strand was inactivated by chemical modifications, preventing its loading into the RISc complex, thereby reducing off-target effects. To avoid a microRNA effect (siRNA binding the 3'UTR and affecting translation), the seed region was used in a Smith-Waterman alignment analysis against human, mouse, and rat coding regions (http://www.invitrogen.com/rnaidesigner). We assessed the in vitro activity of the siRNA by cotransfecting HEK cells (6 x 104 cells per well) with the c-mip expression plasmid (150 ng) and various concentrations of the siRNAs (2, 10, and 20 nM) using Lipofectamine 2000 (Invitrogen). Cells were lysed 24 hours after transfection and total RNA was purified. We quantified c-mip RNA by quantitative real-time fluorescence PCR (QPCR) with the following forward (5'-CTGAACGAGCTCAACGCAGGCAT-3') and reverse (5'-GACAATGTGGCTTCCTGAGACACCA-3') primers. The expression of c-mip was inhibited by 60% by the siRNA G6 and by 85% for G8 and G10. We selected siRNA G8 for in vivo experiments. The stability of siRNA and its delivery to podocytes were confirmed with an siRNA targeting cyclophilin B coupled to Alexa Fluor 647 (X. De Mollerat, Invitrogen).

siRNA treatment Six- to 8-week-old male BALB/c mice weighing 20 to 22 g were purchased from Charles River Laboratories. Labeled (Alexa Fluor 647) Stealth c-mip siRNA (10 mg/kg) was mixed with Invivofectamine [ratio, 1:1 (w/v)] according to the manufacturer's instructions (Invitrogen) and the Invivofectamine–c-mip siRNA complex (100 µl final volume) was injected into the internal jugular vein of mice. LPS (200 µg in a final volume of 200 µl) was injected intraperitoneally into the mice 30 min after the siRNA injection. Control mice were injected with an equal amount of either LPS (n = 5 mice) or Invivofectamine alone (n= 5 mice). Mice were kept in metabolic cages and urine was collected over a 24-hour period. The mice were then killed and their kidneys were collected and processed for immunohistochemical analysis. The efficiency of siRNA delivery was determined by immunofluorescence analysis on kidney cryosections fixed in formalin. The presence and distribution of c-mip were analyzed by immunohistochemistry. To determine whether podocyte induction of c-mip by LPS required T cell or B cell activation, SCID mice, which are deficient in T and B cells, were injected with LPS under similar conditions. We then analyzed the presence of c-mip by immunohistochemistry.

Statistics The data presented are means ± SEM and were prepared with GraphPad Prism software, version 4.0. Mann-Whitney tests were used to evaluate statistical significance. Values of P < 0.05 were considered significant.

Supplementary MaterialsBack to Topwww.sciencesignaling.org/cgi...

Fig. S1. Representative in situ hybridization of serial sections from kidney biopsies from patients with MN and FSGS.

Fig. S2. Detection of c-mip in other glomerular diseases.

Fig. S3. Generation of c-mip transgenic mice.

Fig. S4. PAS staining of kidney sections from 8-week-old wild-type and proteinuric Tg(+) mice.

Fig. S5. Morphological characterization of c-mip transgenic mice.

Fig. S6. Quantification of confocal microscopy analysis of c-mip abundance in glomeruli from MCNS kidney biopsies and renal tissue of Tg(+) mice.

Fig. S7. Ultrastructural analysis of podocytes from 5-day-old newborn transgenic mice.

Fig. S8. Course of glomerular disease in Tg(+) mice.

Fig. S9. Confocal microscopy analysis of the abundance of total and phosphorylated nephrin in kidney sections from 8-week-old wild-type and Tg(+) mice.

Fig. S10. Quantitation of confocal microscopy analysis of phosphorylation of Ser473 in Akt in glomerular diseases.

Fig. S11. Specificity of the c-mip antibody.

Fig. S12. Interaction of c-mip with Fyn and N-WASP.

Fig. S13. Immunogold labeling showing c-mip localization in primary and secondary podocyte foot processes in LPS-treated mice.

Table S1. Patient characteristics at the time of biopsy.

Table S2. Quantification of c-mip abundance in glomeruli of kidney tissues from MCNS patients and Tg(+) mice.

Table S3. Semiquantitative measurement of urinary protein concentration in newborn transgenic mice.

Table S4. Sequence of primers and PCR conditions.

* These authors contributed equally to this work.

To whom correspondence should be addressed. E-mail : dil.sahali@inserm.fr

References and NotesBack to TopL. A. Stevens, A. S. Levey, Measured GFR as a confirmatory test for estimated GFR. J. Am. Soc. Nephrol. 20, 2305–2313 (2009).[Abstract/Free Full Text] K. Tryggvason, J. Patrakka, J. Wartiovaara, Hereditary proteinuria syndromes and mechanisms of proteinuria. N. Engl. J. Med. 354, 1387–1401 (2006).[Free Full Text] D. Kerjaschki, Caught flat-footed : Podocyte damage and the molecular bases of focal glomerulosclerosis. J. Clin. Invest. 108, 1583–1587 (2001).[CrossRef] [Web of Science][Medline] T. Benzing, Signaling at the slit diaphragm. J. Am. Soc. Nephrol. 15, 1382–1391 (2004).[Free Full Text] M. Kestilä, U. Lenkkeri, M. Mannikkö, J. Lamerdin, P. McCready, H. Putaala, V. Ruotsalainen, T. Morita, M. Nissinen, R. Herva, C. E. Kashtan, L. Peltonen, C. Holmberg, A. Olsen, K. Tryggvason, Positionally cloned gene for a novel glomerular protein—nephrin—is mutated in congenital nephrotic syndrome. Mol. Cell 1, 575–582 (1998).[CrossRef] [Web of Science][Medline] N. Boute, O. Gribouval, S. Roselli, F. Benessy, H. Lee, A. Fuchshuber, K. Dahan, M. C. Gubler, P. Niaudet, C. Antignac, NPHS2, encoding the glomerular protein podocin, is mutated in autosomal recessive steroid-resistant nephrotic syndrome. Nat. Genet. 24, 349–354 (2000).[CrossRef] [Web of Science][Medline] J. M. Kim, H. Wu, G. Green, C. A. Winkler, J. B. Kopp, J. H. Miner, E. R. Unanue, A. S. Shaw, CD2-associated protein haploinsufficiency is linked to glomerular disease susceptibility. Science 300, 1298–1300 (2003).[Abstract/Free Full Text] J. M. Kaplan, S. H. Kim, K. N. North, H. Rennke, L. A. Correia, H. Q. Tong, B. J. Mathis, J. C. Rodriguez-Perez, P. G. Allen, A. H. Beggs, M. R. Pollak, Mutations in ACTN4, encoding -actinin-4, cause familial focal segmental glomerulosclerosis. Nat. Genet. 24, 251–256 (2000).[CrossRef] [Web of Science][Medline] J. Reiser, K. R. Polu, C. C. Moller, P. Kenlan, M. M. Altintas, C. Wei, C. Faul, S. Herbert, I. Villegas, C. Avila-Casado, M. McGee, H. Sugimoto, D. Brown, R. Kalluri, P. Mundel, P. L. Smith, D. E. Clapham, M. R. Pollak, TRPC6 is a glomerular slit diaphragm-associated channel required for normal renal function. Nat. Genet. 37, 739–744 (2005).[CrossRef] [Web of Science][Medline] B. Hinkes, R. C. Wiggins, R. Gbadegesin, C. N. Vlangos, D. Seelow, G. Nürnberg, P. Garg, R. Verma, H. Chaib, B. E. Hoskins, S. Ashraf, C. Becker, H. C. Hennies, M. Goyal, B. L. Wharram, A. D. Schachter, S. Mudumana, I. Drummond, D. Kerjaschki, R. Waldherr, A. Dietrich, F. Ozaltin, A. Bakkaloglu, R. Cleper, L. Basel-Vanagaite, M. Pohl, M. Griebel, A. N. Tsygin, A. Soylu, D. Muller, C. S. Sorli, T. D. Bunney, M. Katan, J. Liu, M. Attanasio, J. F. O'Toole, K. Hasselbacher, B. Mucha, E. A. Otto, R. Airik, A. Kispert, G. G. Kelley, A. V. Smrcka, T. Gudermann, L. B. Holzman, P. Nürnberg, F. Hildebrandt, Positional cloning uncovers mutations in PLCE1 responsible for a nephrotic syndrome variant that may be reversible. Nat. Genet. 38, 1397–1405 (2006).[CrossRef] [Web of Science][Medline] M. Simons, K. Schwarz, W. Kriz, A. Miettinen, J. Reiser, P. Mundel, H. Holthöfer, Involvement of lipid rafts in nephrin phosphorylation and organization of the glomerular slit diaphragm. Am. J. Pathol.159, 1069–1077 (2001).[Abstract/Free Full Text] R. Verma, I. Kovari, A. Soofi, D. Nihalani, K. Patrie, L. B. Holzman, Nephrin ectodomain engagement results in Src kinase activation, nephrin phosphorylation, Nck recruitment, and actin polymerization.J. Clin. Invest. 116, 1346–1359 (2006).[CrossRef] [Web of Science][Medline] N. Jones, I. M. Blasutig, V. Eremina, J. M. Ruston, F. Bladt, H. Li, H. Huang, L. Larose, S. S. Li, T. Takano, S. E. Quaggin, T. Pawson, Nck adaptor proteins link nephrin to the actin cytoskeleton of kidney podocytes. Nature 440, 818–823 (2006).[CrossRef][Medline] T. B. Huber, B. Hartleben, J. Kim, M. Schmidts, B. Schermer, A. Keil, L. Egger, R. L. Lecha, C. Borner, H. Pavenstädt, A. S. Shaw, G. Walz, T. Benzing, Nephrin and CD2AP associate with phosphoinositide 3-OH kinase and stimulate AKT-dependent signaling. Mol. Cell. Biol. 23, 4917–4928 (2003).[Abstract/Free Full Text] H. N. Higgs, T. D. Pollard, Regulation of actin filament network formation through ARP2/3 complex : Activation by a diverse array of proteins. Annu. Rev. Biochem. 70, 649–676 (2001).[CrossRef] [Web of Science][Medline] S. Banin, O. Truong, D. R. Katz, M. D. Waterfield, P. M. Brickell, I. Gout, Wiskott–Aldrich syndrome protein (WASp) is a binding partner for c-Src family protein-tyrosine kinases. Curr. Biol. 6, 981–988 (1996).[CrossRef] [Web of Science][Medline] T. B. Huber, C. Kwoh, H. Wu, K. Asanuma, M. Gödel, B. Hartleben, K. J. Blumer, J. H. Miner, P. Mundel, A. S. Shaw, Bigenic mouse models of focal segmental glomerulosclerosis involving pairwise interaction of CD2AP, Fyn, and synaptopodin. J. Clin. Invest. 116, 1337–1345 (2006).[CrossRef][Web of Science][Medline] D. Sahali, A. Pawlak, A. Valanciuté, P. Grimbert, P. Lang, P. Remy, A. Bensman, G. Guellaën, A novel approach to investigation of the pathogenesis of active minimal-change nephrotic syndrome using subtracted cDNA library screening. J. Am. Soc. Nephrol. 13, 1238–1247 (2002).[Abstract/Free Full Text] A. A. Eddy, J. M. Symons, Nephrotic syndrome in childhood. Lancet 362, 629–639 (2003).[CrossRef][Web of Science][Medline] C. Kitiyakara, J. B. Kopp, P. Eggers, Trends in the epidemiology of focal segmental glomerulosclerosis. Semin. Nephrol. 23, 172–182 (2003).[CrossRef] [Web of Science][Medline] A. Meyrier, Nephrotic focal segmental glomerulosclerosis in 2004 : An update. Nephrol. Dial. Transplant. 19, 2437–2444 (2004).[Free Full Text] V. D. D'Agati, A. B. Fogo, J. A. Bruijn, J. C. Jennette, Pathologic classification of focal segmental glomerulosclerosis : A working proposal. Am. J. Kidney Dis. 43, 368–382 (2004).[CrossRef] [Web of Science][Medline] P. W. Mathieson, Minimal change nephropathy and focal segmental glomerulosclerosis. Semin. Immunopathol. 29, 415–426 (2007).[Medline] P. Ronco, H. Debiec, Molecular pathomechanisms of membranous nephropathy : From Heymann nephritis to alloimmunization. J. Am. Soc. Nephrol. 16, 1205–1213 (2005).[Abstract/Free Full Text] J. P. DiNitto, D. G. Lambright, Membrane and juxtamembrane targeting by PH and PTB domains.Biochim. Biophys. Acta 1761, 850–867 (2006).[Medline] D. Filipp, J. Zhang, B. L. Leung, A. Shaw, S. D. Levin, A. Veillette, M. Julius, Regulation of Fyn through translocation of activated Lck into lipid rafts. J. Exp. Med. 197, 1221–1227 (2003).[Abstract/Free Full Text] H. N. Higgs, T. D. Pollard, Activation by Cdc42 and PIP2 of Wiskott-Aldrich syndrome protein (WASp) stimulates actin nucleation by Arp2/3 complex. J. Cell Biol. 150, 1311–1320 (2000).[Abstract/Free Full Text] D. Kerjaschki, T. J. Neale, Molecular mechanisms of glomerular injury in rat experimental membranous nephropathy (Heymann nephritis). J. Am. Soc. Nephrol. 7, 2518–2526 (1996).[Abstract] L. H. Noel, M. Zanetti, D. Droz, C. Barbanel, Long-term prognosis of idiopathic membranous glomerulonephritis. Study of 116 untreated patients. Am. J. Med. 66, 82–90 (1979).[CrossRef] [Web of Science][Medline] P. L. Leenaerts, B. M. Hall, B. J. Van Damme, M. R. Daha, Y. F. Vanrenterghem, Active Heymann nephritis in complement component C6 deficient rats. Kidney Int. 47, 1604–1614 (1995). [Web of Science][Medline] S. T. Spicer, G. T. Tran, M. C. Killingsworth, N. Carter, D. A. Power, K. Paizis, R. Boyd, S. J. Hodgkinson, B. M. Hall, Induction of passive Heymann nephritis in complement component 6-deficient PVG rats. J. Immunol. 179, 172–178 (2007).[Abstract/Free Full Text] S. P. Makker, J. J. Kanalas, Course of transplanted Heymann nephritis kidney in normal host. Implications for mechanism of proteinuria in membranous glomerulonephropathy. J. Immunol. 142, 3406–3410 (1989).[Abstract] S. Doublier, V. Ruotsalainen, G. Salvidio, E. Lupia, L. Biancone, P. G. Conaldi, P. Reponen, K. Tryggvason, G. Camussi, Nephrin redistribution on podocytes is a potential mechanism for proteinuria in patients with primary acquired nephrotic syndrome. Am. J. Pathol. 158, 1723–1731 (2001).[Abstract/Free Full Text] N. Y. Shih, J. Li, V. Karpitskii, A. Nguyen, M. L. Dustin, O. Kanagawa, J. H. Miner, A. S. Shaw, Congenital nephrotic syndrome in mice lacking CD2-associated protein. Science 286, 312–315 (1999).[Abstract/Free Full Text] C. C. Yu, T. S. Yen, C. A. Lowell, A. L. DeFranco, Lupus-like kidney disease in mice deficient in the Src family tyrosine kinases Lyn and Fyn. Curr. Biol. 11, 34–38 (2001).[CrossRef] [Web of Science][Medline] I. Quack, L. C. Rump, P. Gerke, I. Walther, T. Vinke, O. Vonend, T. Grunwald, L. Sellin, β-Arrestin2 mediates nephrin endocytosis and impairs slit diaphragm integrity. Proc. Natl. Acad. Sci. U.S.A. 103, 14110–14115 (2006).[Abstract/Free Full Text] N. Jones, L. A. New, M. A. Fortino, V. Eremina, J. Ruston, I. M. Blasutig, L. Aoudjit, Y. Zou, X. Liu, G. L. Yu, T. Takano, S. E. Quaggin, T. Pawson, Nck proteins maintain the adult glomerular filtration barrier. J. Am. Soc. Nephrol. 20, 1533–1543 (2009).[Abstract/Free Full Text] J. Reiser, G. von Gersdorff, M. Loos, J. Oh, K. Asanuma, L. Giardino, M. P. Rastaldi, N. Calvaresi, H. Watanabe, K. Schwarz, C. Faul, M. Kretzler, A. Davidson, H. Sugimoto, R. Kalluri, A. H. Sharpe, J. A. Kreidberg, P. Mundel, Induction of B7-1 in podocytes is associated with nephrotic syndrome. J. Clin. Invest. 113, 1390–1397 (2004).[CrossRef] [Web of Science][Medline] Y. Sun, L. He, M. Takemoto, J. Patrakka, T. Pikkarainen, G. Genové, J. Norlin, K. Truvé, K. Tryggvason, C. Betsholtz, Glomerular transcriptome changes associated with lipopolysaccharide-induced proteinuria. Am. J. Nephrol. 29, 558–570 (2009).[CrossRef] [Web of Science][Medline] S.-y. Zhang, A. Marlier, O. Gribouval, T. Gilbert, L. Heidet, C. Antignac, M. C. Gubler, In vivo expression of podocyte slit diaphragm-associated proteins in nephrotic patients with NPHS2 mutation. Kidney Int. 66, 945–954 (2004).[CrossRef] [Web of Science][Medline] P. Mundel, J. Reiser, A. Zúñiga Mejía Borja, H. Pavenstädt, G. R. Davidson, W. Kriz, R. Zeller, Rearrangements of the cytoskeleton and cell contacts induce process formation during differentiation of conditionally immortalized mouse podocyte cell lines. Exp. Cell Res. 236, 248–258 (1997).[CrossRef] [Web of Science][Medline] S. K. Bronson, E. G. Plaehn, K. D. Kluckman, J. R. Hagaman, N. Maeda, O. Smithies, Single-copy transgenic mice with chosen-site integration. Proc. Natl. Acad. Sci. U.S.A. 93, 9067–9072 (1996).[Abstract/Free Full Text] J. L. Michaud, L. I. Lemieux, M. Dube, B. C. Vanderhyden, S. J. Robertson, C. R. Kennedy, Focal and segmental glomerulosclerosis in mice with podocyte-specific expression of mutant -actinin-4. J. Am. Soc. Nephrol. 14, 1200–1211 (2003).[Abstract/Free Full Text] Acknowledgments : We thank C. R. J. Kennedy (Ottawa Health Research Institute, Ontario, Canada) for providing the nephrin promoter ; M. D. Resh (Department of Cell Biology and Genetics, Memorial Sloan-Kettering Cancer Center, New York, NY), and J. Huot (Centre de recherche de L'Hôtel-Dieu de Québec, Canada) for providing the Fyn plasmids ; P. Mundel (Mount Sinai School of Medicine, New York, NY) for providing the podocyte cell line ; T. Benzing (Renal Division, University Hospital Freiburg, Freiburg, Germany) for providing the nephrin plasmid ; C. Antignac (INSERM U574, Hôpital Necker Enfant-Malades, Paris, France) for providing the antibody against podocin ; L. Holzman (Medical Science Research, Ann Arbor, MI) for providing the antibody against phosphorylated nephrin ; X. de Mollerat (Invitrogen) for technical assistance with RNAi experiments and for providing the cyclophilin-targeting siRNA ; Liliane (Biochemistry Department, Henri Mondor Hospital) for biochemical determinations ; L. Kheuang, V. Fataccioli, and A. Manceau (Pathology Department) for technical assistance with electron microscopy ; Y. Allory (Pathology Department) for providing renal samples ; and R. Souktani (the animal facility laboratory at the Institut Mondor de Recherche Biomédicale, Créteil) for assistance with microinjection experiments in mice. Funding : This work was supported in part by an Avenir Program from INSERM, a grant from the French Kidney Foundation, Association pour l'Utilisation du Rein Artificiel (AURA), and Assistance Publique des Hôpitaux de Paris (AP-HP, Programme hospitalier de recherche clinique). Author contributions : S.-y.Z., M.K., K.D., A.P., V.O., V.A., M.C., F.B.M., M.M., C.C., X.D., and V.B. performed the experiments. G.M. collected clinical data. P.L., G.G., P.R., and D.S. wrote the paper. D.S. supervised the project. All authors discussed the results and participated in writing the paper. Competing interests : The authors declare that they do not have any competing financial, personal, or professional interests.

Citation : S. y. Zhang, M. Kamal, K. Dahan, A. Pawlak, V. Ory, D. Desvaux, V. Audard, M. Candelier, F. B. Mohamed, M. Matignon, C. Christov, X. Decrouy, V. Bernard, G. Mangiapan, P. Lang, G. Guellaën, P. Ronco, D. Sahali, c-mip Impairs Podocyte Proximal Signaling and Induces Heavy Proteinuria. Sci. Signal. 3, ra39 (2010).

compléments du 18 mai 2010 science signaling (anglais)

Vincent Palmier — 2010-05-19T05:55:14Z

AMSN sur la Normandy Channel Race

Vincent Palmier — 2010-05-19T05:41:04Z

On y était ! Je vous laisse découvrir quelques photos de ce superbe départ.

Publication du 18 mai 2010

Vincent Palmier — 2010-05-17T12:11:24Z